Rat ECM1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Gene

Species

Rat

NCBI Ref Seq

NM_053882.1

RefSeq ORF Size

1689bp

Gene Synonym

Ecm1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat extracellular matrix protein 1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Extracellular matrix protein 1 (ECM1) is a secreted glycoprotein and playing a pivotal role in endochondral bone formation, angiogenesis, and tumour biology. Three splice variants have been identified: ECM1a (540 aa) is most widely expressed, with highest expression in the placenta and heart; ECM1b (415 aa) is differentiation-dependent expressed and found only in tonsil and associated with suprabasal keratinocytes; ECM1c (559 aa) accounts for approximately 15% of skin ECM1. Although ECM1 is not tumor specific, is significantly elevated in many malignant epithelial tumors and is suggested as a possible trigger for angiogenesis, tumor progression and malignancies. It also has been shown to regulate endochondral bone formation, skeletal development and tissue remodeling.

References

Oyama N, et al. (2003) Autoantibodies to extracellular matrix protein 1 in lichen sclerosus. Lancet. 362(9378): 118-23.

Chan I, et al. (2004) Rapid diagnosis of lipoid proteinosis using an anti-extracellular matrix protein 1 (ECM1) antibody. J Dermatol Sci. 35(2): 151-3.

Lupo I, et al. (2005) A novel mutation of the extracellular matrix protein 1 gene (ECM1) in a patient with lipoid proteinosis (Urbach-Wiethe disease) from Sicily. Br J Dermatol. 153(5): 1019-22.

Sander CS, et al. (2006) Expression of extracellular matrix protein 1 (ECM1) in human skin is decreased by age and increased upon ultraviolet exposure. Br J Dermatol. 154(2): 218-24.

Catalog Number:MGC372-NF