Rat DSC2 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:MGC302-NO

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2709bp
Gene Synonym
Dsc2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat desmocollin 2 Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
DSC2 is a calcium-dependent glycoprotein that is a member of the desmocollin subfamily of the cadherin superfamily. Like other desmocollins, murine DSC2 has two products, Dsc2a and Dsc2b, produced by alternative splicing of a 46 bp exon which encodes 11 COOH-terminal aa followed by an in-frame stop codon. These desmosomal family members, along with the desmogleins, are found primarily in epithelial cells where they constitute the adhesive proteins of the desmosome cell-cell junction and are required for cell adhesion and desmosome formation. The desmosomal family members are arranged in two clusters on chromosome 18, occupying less than 650 kb combined. Mutations in DSC2 are associated with arrhythmogenic right ventricular dysplasia-11. DSC2 is Involved in the interaction of plaque proteins and intermediate filaments mediating cell-cell adhesion. DSC2 may contribute to epidermal cell positioning by mediating differential adhesiveness between cells that express different isoforms.
References
  • Nuber UA, et al. (1995) The widespread human desmocollin Dsc2 and tissue-specific patterns of synthesis of various desmocollin subtypes. Eur J Cell Biol. 66 (1): 69-74.
  • Marsden MD, et al. (1997) Cloning and transcriptional analysis of the promoter of the human type 2 desmocollin gene (DSC2). Gene. 186 (2): 237-47.
  • Greenwood MD, et al. (1997) Exon-intron organization of the human type 2 desmocollin gene (DSC2): desmocollin gene structure is closer to "classical" cadherins than to desmogleins. Genomics. 44 (3): 330-5.
  • TOP