Mouse DPP7 / DPPII / DPP2 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_031843.2

RefSeq ORF Size

1521bp

Gene Synonym

QPP, Dpp2, DPPII, Dpp7

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse dipeptidylpeptidase 7 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

DPP7 (dipeptidylpeptidase 7), also known as DPPII and DPP2, is a post-proline cleaving aminopeptidase expressed in quiescent lymphocytes. Dipeptidyl peptidases (DPPs) have post-proline dipeptidyl aminopeptidase activity, cleaving Xaa-Pro dipeptides from the N-termini of proteins. DPPs mediate regulatory activity of their substrates and have been linked to a variety of diseases including type 2 diabetes, obesity and cancer. DPPs can bind specific voltage-gated potassium channels and alter their expression and biophysical properties and may also influence T cells. DPP proteins include DPRP1, DPRP2, DPP3, DPP7, DPP10, DPPX and CD26. It localizes to lysosomes. DPP7 localizes to lysosomes and exists as a homodimer via its leucine zipper motif and is involved in the degradation of oligopeptides. In response to calcium release, it can be secreted in its active form. It is essential for lymphocyte survival, as the inhibition of DPP7 results in quiescent cell apoptosis.

References

Chiravuri M, et al. (1999) A novel apoptotic pathway in quiescent lymphocytes identified by inhibition of a post-proline cleaving aminodipeptidase: a candidate target protease, quiescent cell proline dipeptidase. J Immunol. 163(6):3092-9.

Fukasawa KM, et al. (2001) Cloning and functional expression of rat kidney dipeptidyl peptidase II. Biochem J. 353(Pt 2):283-90.

Fornas E, et al. (1992) Effect of cholesterol and its autooxidation derivatives on endocytosis and dipeptidyl peptidases of aortic endothelial cells. Histol Histopathol. 7(2):163-8.

Catalog Number:MGC285-CY