Rhesus DPP4 / CD26 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Rhesus

NCBI Ref Seq

NM_001039190.1

RefSeq ORF Size

2301bp

Gene Synonym

DPP4

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rhesus dipeptidyl-peptidase 4 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Dipeptidyl peptidase-4 (DPP4) or adenosine deaminase complexing protein 2 (ADCP 2) or T-cell activation antigen CD26 is a serine exopeptidase belonging to the S9B protein family that cleaves X-proline dipeptides from the N-terminus of polypeptides, such as chemokines, neuropeptides, and peptide hormones. The enzyme is a type II transmembrane glycoprotein, expressed on the surface of many cell types. It is also present in serum and other body fluids in a truncated form (sCD26/DPPIV). The soluble CD26 (sCD26) as a tumour marker for the detection of colorectal cancer (CRC) and advanced adenomas. As both a regulatory enzyme and a signalling factor, DPP4 has been evaluated and described in many studies. DPP4 inhibition results in increased blood concentration of the incretin hormones glucagon-like peptide-1 (GLP-1) and gastric inhibitory polypeptide (GIP). This causes an increase in glucose-dependent stimulation, resulting in a lowering of blood glucose levels. Recent studies have shown that DPP4 inhibitors can induce a significant reduction in glycosylated haemoglobin (HbA(1c)) levels, either as monotherapy or as a combination with other antidiabetic agents. Research has also demonstrated that DPP4 inhibitors portray a very low risk of hypoglycaemia development, and are a new pharmacological class of drugs for treating Type 2 diabetes.

References

Doupis J, et al. (2008) DPP4 inhibitors: a new approach in diabetes treatment. Adv Ther. 25(7): 627-43.

Havre PA, et al. (2008) The role of CD26/dipeptidyl peptidase IV in cancer. Front Biosci. 13: 1634-45.

De Chiara L, et al. (2009) Soluble CD26 levels and its association to epidemiologic parameters in a sample population. Dis Markers. 7(6): 311-6.

Matteucci E, et al. (2009) Dipeptidyl peptidase-4 (CD26): knowing the function before inhibiting the enzyme. Curr Med Chem. 16(23): 2943-51.

Catalog Number:MGC283-NM