Mouse DPP10 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_199021.3

RefSeq ORF Size

2403bp

Gene Synonym

DPPX, Dprp3, 6430601K09Rik, Dpp10

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse dipeptidylpeptidase 10 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Inactive dipeptidyl peptidase 10, also known as Dipeptidyl peptidase IV-related protein 3, Dipeptidyl peptidase X, Dipeptidyl peptidase-like protein 2, DPRP-3, DPL2 and DPP10, is a single-pass type I I membrane protein which belongs to the peptidase S9B family. DPPIV subfamily. It may modulate cell surface expression and activity of the potassium channels KCND1 and KCND2. DPP10 / DPRP3 has no detectable protease activity, most likely due to the absence of the conserved serine residue normally present in the catalytic domain of serine proteases. However, it does bind specific voltage-gated potassium channels and alters their expression and biophysical properties. Genetic variations in DPP10 are associated with susceptibility to asthma (ASTHMA). The most common chronic disease affecting children and young adults. It is a complex genetic disorder with a heterogeneous phenotype, largely attributed to the interactions among many genes and between these genes and the environment. It is characterized by recurrent attacks of paroxysmal dyspnea, with weezing due to spasmodic contraction of the bronchi.

References

Nagase T., et al., 2000, DNA Res. 7:143-150.

Allen M., et al., 2003, Nat. Genet. 35:258-263.

Qi SY, et al.,2003, Biochem J 373 (Pt 1): 179-89.

Chen T., et al., 2003, Adv. Exp. Med. Biol. 524:79-86.

Zagha E., et al., 2005, J. Biol. Chem. 280:18853-61.

Catalog Number:MGC281-CY