Mouse DOPA Decarboxylase/DDC Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Mouse

NCBI Ref Seq

NM_001190448.1

RefSeq ORF Size

1443bp

Gene Synonym

Aadc, Ddc

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse dopa decarboxylase Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Dopa Decarboxylase (DDC), also known as AADC and Aromatic-L-amino acid decarboxylase, is a 54 kDa member of the group II decarboxylase family of proteins.It is a vitamin B6-dependent homodimeric enzyme that catalyzes the decarboxylation of both L-3,4-dihydroxyphenylalanine (L-DOPA) and L-5-hydroxytryptophan to dopamine and serotonin, respectively, which are major mammalian neurotransmitters and hormones belonging to catecholamines and indoleamines. Since L-DOPA is regularly used to treat the symptoms of Parkinson's disease, the catalytic pathway is of particular research interest. Defects of DDC are associated with severe developmental delay, oculogyric crises (OGC), as well as autosomal recessive disorder AADC deficiency, an early onset inborn error in neurotransmitter metabolism which can lead to catecholamine and serotonin deficiency.

References

Ichinose, H. et al.,1989,Biochem. Biophys. Res. Commun. 164: 1024-1030.

Lisa, J. S. et al., 1992, Genomics 13: 469-471.

Moore, P. S. et al.,1996, Biochem. J. 315:249-256.

Bertoldi, M. et al., 2003, Biochim. Biophys. Acta. 1647:42-47.

Vassilacopoulou, D. et al., 2004, Neurochem. Res. 29: 1817-1823.

Ma, J.Z., et al., 2005, Hum. Mol. Genet. 14: 1691-1698.

Catalog Number:MGC270-CM