Rat DLL1 / Delta-like 1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Gene

Species

Rat

NCBI Ref Seq

NM_032063.1

RefSeq ORF Size

2145bp

Gene Synonym

Dll1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat delta-like 1 (Drosophila) Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Delta-like protein 1(DLL1), also known as Delta1, a single-pass type I membrane protein which contains one DSL domain and eight EGF-like domains, acts as a ligand for Notch receptors, and positively regulates T-cell development. DLL1 is proteolytically processed in a similar manner to the Notch receptor, and it has been speculated to participate in bidirectional signaling. The proteolytic processing of DLL1 helps achieve an asymmetry in Notch signaling in initially equivalent myogenic cells and helps sustain the balance between differentiation and self-renewal. Interactions between DLL1 and Notch in trans activate the Notch pathway, whereas DLL1 binding to Notch in cis inhibits Notch signaling. DLL1 undergoes proteolytic processing in its extracellular domain by ADAM10. It had been demonstrated that DLL1 represents a substrate for several other members of the ADAM family. In co-transfected cells, DLL1 is constitutively cleaved by ADAM12, and the N-terminal fragment of DLL1 is released to medium. ADAM12-mediated cleavage of DLL1 is cell density-dependent, takes place in cis orientation, and does not require the presence of the cytoplasmic domain of ADAM12. Full-length DLL1, but not its N- or C-terminal proteolytic fragment, co-immunoprecipitates with ADAM12. By using a Notch reporter construct, we show that DLL1 processing by ADAM12 increases Notch signaling in a cell-autonomous manner. Furthermore, ADAM9 and ADAM17 have the ability to process DLL1. In contrast, ADAM15 does not cleave DLL1, although the two proteins still co-immunoprecipitate with each other. During fetal development, DLL1 is an essential Notch ligand in the vascular endothelium of large arteries to activate Notch1 and maintain arterial identity. DLL1-Notch signaling was required for VEGF receptor expression in fetal arteries.

References

Dyczynska E, et al. (2007) Proteolytic processing of delta-like 1 by ADAM proteases. J Biol Chem. 282(1): 436-44.

Sun D, et al. (2008) The role of Delta-like 1 shedding in muscle cell self-renewal and differentiation. J Cell Sci. 121(Pt 22): 3815-23.

Srensen I, et al. (2009) DLL1-mediated Notch activation regulates endothelial identity in mouse fetal arteries. Blood. 113(22): 5680-8.

Catalog Number:MGC227-NF