Mouse DIM1/TXNL4A Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Mouse

NCBI Ref Seq

NM_025299.3

RefSeq ORF Size

429bp

Gene Synonym

Dim1; Txnl4; U5-15kD; U5-15kDa; D18Wsu98e; ENSMUSG00000057130

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse thioredoxin-like 4A Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

DIM1, also known as TXNL4A, is a member of the Dim protein family. The Dim protein family is composed of two classes, DIM1and Dim2, which share a common thioredoxin-like fold. They were originally identified for their role in cell cycle progression and have been found to interact with Prp6, an essential component of the spliceosome, which forms the bridge of U4/U6.U5-tri-snRNP. In spite of their biological and structural similarities, DIM1 and Dim2 proteins differ in many aspects. DIM1 bears distinctive structural motifs responsible for its interaction with other spliceosome components. Dim2 forms homodimers and contains specific domains required for its interactions with partners. This originality suggests that although both proteins are involved in pre-mRNA splicing, they are likely to be involved in different biological pathways. DIM1 interacts with HNRPF, HNRPH2, NEDD9/HEF1 and PQBP1/NPW38. It plays an essential role in pre-mRNA splicing.

References

Zhang Y, et al. (2001) Evidence that dim1 associates with proteins involved in pre-mRNA splicing, and delineation of residues essential for dim1 interactions with hnRNP F and Npw38/PQBP-1. Gene. 257 (1): 33-43.

Zhang YZ, et al. (2003) Structure, stability, and function of hDim1 investigated by NMR, circular dichroism, and mutational analysis. Biochemistry. 42(32):9609-18.

Zhang Y, et al. (2000) Evidence that dim1 associates with proteins involved in pre-mRNA splicing, and delineation of residues essential for dim1 interactions with hnRNP F and Npw38/PQBP-1. Gene. 257 (1):33-43.

Zhang YZ, et al. (2000) The evolutionarily conserved Dim1 protein defines a novel branch of the thioredoxin fold superfamily. Physiol Genomics. 1(3):109-18.

Catalog Number:MGC211-NM