Rhesus Dectin-1/CLEC7A Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Rhesus

NCBI Ref Seq

NM_001032943.1

RefSeq ORF Size

744bp

Gene Synonym

CLEC7A

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rhesus C-type lectin domain family 7, member A Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Dectin-1 was recently identified as the most important receptor for beta-glucan. It is a type II transmembrane protein which binds beta-1,3 and beta-1,6 glucans, and is expressed on most cells of the innate immune system and has been implicated in phagocytosis as well as killing of fungi by macrophages, neutrophils and dendritic cells. Recognition of beta-glucan by dectin-1 triggers effective immune response, including phagocytosis and proinflammatory factor production, to eliminate infecting fungi, which especially benefits immunocompromised patients against opportunistic fungal infection. In addition, dectin-1 is involved in the adaptive immune response as well as autoimmune diseases and immune tolerance. Dectin-1 can recognize and respond to live fungal pathogens and is being increasingly appreciated as having a key role in the innate responses to these pathogens. In addition to its exogenous ligands, Dectin-1 can recognize an unidentified endogenous ligand on T cells and may act as a co-stimulatory molecule. Recent studies have highlighted the importance of Dectin-1 in anti-fungal immunity, in both mice and humans, and have suggested a possible involvement of this receptor in the control of mycobacterial infections.

References

Herre J, et al. (2004) The role of Dectin-1 in antifungal immunity. Crit Rev Immunol. 24(3): 193-203.

Brown GD. (2006) Dectin-1: a signalling non-TLR pattern-recognition receptor. 6(1): 33-43.

Sun L, et al. (2007) The biological role of dectin-1 in immune response. Int Rev Immunol. 26(5-6): 349-64.

Schorey JS, et al. (2008) The pattern recognition receptor Dectin-1: from fungi to mycobacteria. Curr Drug Targets. 9(2): 123-9.

Reid DM, et al. (2009) Pattern recognition: recent insights from Dectin-1. Curr Opin Immunol. 21(1): 30-7.

Catalog Number:MGC140-NY