Mouse DDR1/MCK10/CD167 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Mouse

NCBI Ref Seq

NM_172962.1

RefSeq ORF Size

2625bp

Gene Synonym

Cak, Nep, PTK3A, CD167a

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse discoidin domain receptor family, member 1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Discoidin domain receptor family, member 1 (DDR1), also known as or CD167a (cluster of differentiation 167a), and Mammary carcinoma kinase 10 (MCK10), belongs to a subfamily of tyrosine kinase receptors with an extracellular domain homologous to Dictyostellium discoideum protein discoidin 1. Receptor tyrosine kinases play a key role in the communication of cells with their microenvironment. These kinases are involved in the regulation of cell growth, differentiation and metabolism. Expression of DDR1/MCK10/CD167 is restricted to epithelial cells, particularly in the kidney, lung, gastrointestinal tract, and brain. In addition, it has been shown to be significantly overexpressed in several human tumors. DDR1/MCK10/CD167 plays an important role in regulating attachment to collagen, chemotaxis, proliferation, and MMP production in smooth muscle cells. DDR1 functions in a feedforward loop to increase p53 levels and at least some of its effectors. Inhibition of DDR1 function resulted in strikingly increased apoptosis of wild-type p53-containing cells in response to genotoxic stress through a caspase-dependent pathway.

References

Hou G, et al. (2001) The discoidin domain receptor tyrosine kinase DDR1 in arterial wound repair. J Clin Invest. 107(6): 727-35.

Ongusaha PP, et al. (2003) p53 induction and activation of DDR1 kinase counteract p53-mediated apoptosis and influence p53 regulation through a positive feedback loop. EMBO J. 22(6): 1289-301.

Jönsson M, et al. (2001) Repression of Wnt-5a impairs DDR1 phosphorylation and modifies adhesion and migration of mammary cells. J Cell Sci. 114(11): 2043-53.

Catalog Number:MGC115-CF