Mouse Cystatin E / CST6 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:MGC024-NM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
450bp
Gene Synonym
ichq, N28197, 1110017E11Rik, Cst6
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse cystatin E/M Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Cystatin E/M, also referred to as CST6, is a member of type 2 cysteine proteinase inhibitors of the cystatin superfamily, and inhibits papain and cathepsin B. Cystatin E is a low molecular mass secreted protein existing in both a glycosylated (17 kDa) and an unglycosylated (14 kDa) form, with two characteristic intrachain disulfide bridges. Expression of cystatin M/E is found to be restricted to the epidermis, more specifically in the stratum granulosum, sweat glands, sebaceous glands, and the hair follicles. In addition to its function as a cysteine protease inhibitor, cystatin M/E also serves as a target for cross-linking by transglutaminases. Accordingly, cystatin M/E was suggested to be involved in barrier formation and maintenance. Furthermore, studies have revealed that cystatin M/E is frequently epigenetically inactivated during breast carcinogenesis, and thus be regarded as a candidate of tumour suppressor gene.
References
TOP