Rhesus CXCL9 / MIG Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Rhesus

NCBI Ref Seq

NM_001032936.1

RefSeq ORF Size

378bp

Gene Synonym

CXCL9

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rhesus chemokine (C-X-C motif) ligand 9 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Chemokine (C-X-C motif) ligand 9 (CXCL9), also known as Monokine induced by gamma interferon (MIG), is a small cytokine belonging to the CXC chemokine family. The function of this chemokine has not been specifically defined; however, it is thought to be involved in T cell trafficking. CXCL9/MIG functions as one of the three ligands of chemokine receptor CXCR3 which is a G protein-coupled receptor found predominantly on T cells. CXCL9/MIG, together with CXCL10 and CXCL11, may activate CXCR3 by binding to it. CXCL9 serves as a cytokine that affects the growth, movement, or activation state of cells that participate in immune and inflammatory response. It has been observed that tumour endothelial cells secrete high levels of CXCL9 in all, and CXCL10 in most melanoma metastases. Experiment data represent novel mechanisms by which tumour cells in melanoma metastases might use the chemokine-expressing endothelium to leave the tumour and eventually to form additional metastases at distinct sites. Experiment results also improved that CXCL9/MIG plays an important role in CD4+ T lymphocyte recruitment and development of CAV, MOMA-2+ macrophages are the predominant recipient-derived source of CXCL9/MIG, and recipient CD4 lymphocytes are necessary for sustained CXCL9/MIG production and CAV development in this model. Neutralization of the chemokine CXCL9/MIG may have therapeutic potential for the treatment of chronic rejection after heart transplantation.

References

Ruehlmann JM, et al. (2001) MIG (CXCL9) chemokine gene therapy combines with antibody-cytokine fusion protein to suppress growth and dissemination of murine colon carcinoma. Cancer Res. 61(23): 8498-503.

Belperio JA, et al. (2003) Role of CXCL9/CXCR3 chemokine biology during pathogenesis of acute lung allograft rejection. J Immunol. 171(9): 4844-52.

Colvin RA, et al. (2004) Intracellular domains of CXCR3 that mediate CXCL9, CXCL10, and CXCL11 function. J Biol Chem. 279(29): 30219-27.

Valbuena G, et al. (2003) Expression analysis of the T-cell-targeting chemokines CXCL9 and CXCL10 in mice and humans with endothelial infections caused by rickettsiae of the spotted fever group. Am J Pathol. 163(4): 1357-69.

Catalog Number:MGB949-CF