Rat CXCL16 / SR-PSOX Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

NM_001017478.1

RefSeq ORF Size

744bp

Gene Synonym

CXCL16

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat chemokine (C-X-C motif) ligand 16 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

C-X-C motif chemokine 16, also known as Small-inducible cytokine B16, SR-PSOX, and CXCL16, is a single-pass type I membrane protein which belongs to the intercrine alpha (chemokine CxC) family. CXCL16 exists in transmembrane and soluble forms. The transmembrane form acts as a scavenger receptor for oxidised LDL whereas the soluble form acts a chemoattractant for mainly CD8+ T cells. CXCL16 is a protein which shares pattern recognition receptor functions, relevant for adhesion and phagocytosis of bacterial products, with the properties of an adhesion molecule and inflammatory chemokine. CXCL16/SR-PSOX is an interferon-gamma-regulated chemokine and scavenger receptor for oxidized low-density lipoprotein that is expressed in atherosclerotic lesions. Proteolytic cleavage of membrane-bound CXCL16 releases soluble CXCL16, which may promote migration of effector T cells and augment a proatherogenic inflammatory response. CXCL16/SR-PSOX can be a potential player in atherogenesis. Enhanced expression of CXCL16 has been demonstrated in atherosclerotic plaques and several properties have been attributed to CXCL16 that could influence the atherosclerotic process. Following in vitro studies suggested that as an adhesion molecule CXCL16/SR-PSOX might mediate T-cell adhesion to the endothelium, as a chemokine-drive T-cell migration, stimulate cell proliferation and elicit inflammatory phenotype in smooth muscle cells (SMC) and, finally, as a scavenger receptor-mediate uptake of atherogenic lipoproteins by macrophages and SMC. CXCR6 and its ligand CXCL16 in regulating metastasis and invasion of cancer. CXCR6 and CXCL16 are up-regulated in multiple cancer tissue types and cancer cell lines relative to normal tissues and cell lines. In addition, both CXCR6 and CXCL16 levels increase as tumor malignancy increases. Thus, CXCL16 and CXCR6 may mark cancers arising in an inflammatory milieu and mediate pro-tumorigenic effects of inflammation through direct effects on cancer cell growth and by inducing the migration and proliferation of tumor-associated leukocytes.

References

Sheikine Y, et al. (2008) CXCL16/SR-PSOX--a friend or a foe in atherosclerosis? Atherosclerosis. 197(2): 487-95.

Lehrke M, et al. (2008) CXCL16 is a surrogate marker of inflammatory bowel disease. Scand J Gastroenterol. 43(3): 283-8.

Jansson AM, et al. (2009) Soluble CXCL16 predicts long-term mortality in acute coronary syndromes. Circulation. 119(25): 3181-8.

Darash-Yahana M, et al. (2009) The chemokine CXCL16 and its receptor, CXCR6, as markers and promoters of inflammation-associated cancers. PLoS One. 4(8): e6695.

Deng L, et al. (2010) CXCR6/CXCL16 functions as a regulator in metastasis and progression of cancer. Biochim Biophys Acta. 1806(1): 42-9.

Catalog Number:MGB942-CM