Mouse CXADR / CAR transcript variant 1 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:MGB937-NY

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1098bp
Gene Synonym
CAR, MCAR, MCVADR, AU016810, AW553441, 2610206D03Rik
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse coxsackie virus and adenovirus receptor, transcript variant 1 Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CXADR (coxsackie virus and adenovirus receptor), also known as CAR, is a type I  transmembrane glycoprotein belonging to the CTX family of the Ig superfamily, and is essential for normal cardiac development in the mouse. Proposed as a homophilic cell adhesion molecule, CXADR is a component of the epithelial apical junction complex that is essential for the tight junction integrity, and probably involved in transepithelial migration of polymorphonuclear leukocytes (PMN). Mature mouse CXADR structrually comprises a 218 aa extracellular domain (ECD) with a V-type (D1) and a C2-type (D2) Ig-like domain, a 21 aa transmembrane segment and a 107 aa intracellular domain, among which,D1 is thought to be responsible for homodimer formation in trans within tight junctions. The ECD of mouse CXADR shares 97%, 90% sequence identity with the corresponding regions of rat, human CXADR.
References
  • Tomko, R.P. et al., 1997, Proc. Natl. Acad. Sci. U.S.A. 94 (7): 3352–3356.
  • van Raaij , M.J. et al., 2001, Structure. 8 (11): 1147–1155.
  • Cohen, C.J. et al., 2001, J. Biol. Chem. 276 (27): 25392–25398.
  • Carson, S.D. et al., 2002, Rev. Med. Virol. 11 (4): 219–226.
  • Selinka, H.C. et al., 2004, Med. Microbiol. Immunol. 193 (2-3): 127–131.
  • Philipson, L. et al., 2004, Curr. Top. Microbiol. Immunol. 273:87-111.
  • Raschperger, E. et al., 2006, Exp. Cell Res. 312: 1566-1580.
  • TOP