Mouse CUTC Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:MGB930-NF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
819bp
Gene Synonym
CGI-32; AI326282; 2310039I18Rik
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse cutC copper transporter homolog (E.coli) Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Copper homeostasis protein cutC homolog, also known as CGI-32 and CUTC, is a cytoplasm and nucleus protein which belongs to the CutC family. CUTC may play a role in copper homeostasis. It can bind one Cu1+ per subunit. Copper is an essential trace element to life and particularly plays a pivotal role in the physiology of aerobic organisms. Copper is a micronutrient that is required for proper metabolic functioning of most prokaryotic and eukaryotic organisms. To sustain an adequate supply of copper, a cell requires molecular mechanisms that control the metal content to avoid copper toxicity. This toxicity comes primarily from the reactivity of copper, which can lead to the generation of free radicals. In bacteria, two independent systems are responsible for maintaining the balance of copper within the cells ( Cop and Cut family proteins ). The Cut protein family is associated with copper homeostasis and involved in uptake, storage, delivery, and efflux of copper. CutC is a member of the Cut family and is suggested to be involved in efflux trafficking of cuprous ion. CutC is able to respond transcriptionally to copper and to participate in the control of copper homeostasis in E. faecalis.
References
  • Lai C.-H., et al., 2000, Genome Res.10:703-713.
  • Li J., et al., 2005, Biochem. Biophys. Res. Commun. 337:179-183.
  • Li,Y. et al., 2010, J Struct Biol. 169 (3):399-405.
  • Burkard T.R., et al., 2011, BMC Syst. Biol. 5:17-17.
  • TOP