Mouse CTSC / DPPI ORF mammalian expression plasmid, N-His tag Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Gene

Species

Mouse

NCBI Ref Seq

NM_009982.4

RefSeq ORF Size

1410 bp

Gene Synonym

AI047818,DPP1,DPPI

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse cathepsin C Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-OFPSpark

Restriction Site

KpnI + XbaI(6kb+1.41kb)

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Cathepsins are proteases found in many types of cells conserved in all animals, which have a vital role in mammalian cellular turnover such as bone resorption. The lysosomal cysteine protease Cathepsin C (CTSC), also known as dipeptidyl peptidase I (DPPI/DPP1), activates a number of granule-associated serine proteases with pro-inflammatory and immune functions by removal of their inhibitory N-terminal dipeptides. This lysosomal exo-cysteine protease belonging to the peptidase C1 family. Active cathepsin C is found in lysosomes as a 200-kDa multimeric enzyme. Subunits constituting this assembly all arise from the proteolytic cleavage of a single precursor giving rise to three peptides: the propeptide, the alpha- and the beta-chains. It is a central coordinator for activation of many serine proteases in immune/inflammatory cells. Defects in the Cathepsin C have been shown to be a cause of Papillon-Lefevre disease, an autosomal recessive disorder characterized by palmoplantar keratosis and periodontitis. Cathepsin C plays a key role in the activation of several degradative enzymes linked to tissue destruction in inflammatory diseases. Thus, it is a therapeutic target for the treatment of a number of inflammatory and autoimmune diseases.

References

Santilman V, et al. (2002) Importance of the propeptide in the biosynthetic maturation of rat cathepsin C. Eur J Cell Biol. 81(12): 654-63.

Kam CM, et al. (2004) Design and evaluation of inhibitors for dipeptidyl peptidase I (Cathepsin C). Arch Biochem Biophys. 427(2): 123-34.

Noack B, et al. (2008) Cathepsin C gene variants in aggressive periodontitis. J Dent Res. 87(10): 958-63.

Laine DI, et al. (2010) Inhibitors of cathepsin C (dipeptidyl peptidase I). Expert Opin Ther Pat. 20(4): 497-506.

Catalog Number:MGB915-NO