Mouse CTLA-4/CD152 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:MGB902-CO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
654bp
Gene Synonym
Cd152, Ly-56, Ctla-4, Ctla4
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse cytotoxic T-lymphocyte-associated protein 4 Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
HindIII + XbaI (6kb + 0.66kb)
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Cytotoxic T-lymphocyte protein 4, also known as CTLA4 and CD152, is a single-pass type I membrane protein and a member of the immunoglobulin superfamily. It is the second member of the CD28 receptor family. The ligands or counterreceptors for these two proteins are the B7 family members, CD80 (B7-1) and CD86 (B7-2). CTLA4 transmits an inhibitory signal to T cells, whereas CD28 transmits a stimulatory signal. Intracellular CTLA4 is also found in regulatory T cells and may play an important role in their functions. CD152 or cytotoxic T lymphocyte antigen-4 (CTLA-4) is an essential receptor involved in the negative regulation of T cell activation. Because of its profound inhibitory role, CD152 has been considered a sound susceptible candidate in autoimmunity and a persuasive target for cancer immunotherapy. In particular, recent evidence suggests that CD152 is also important in the homeostasis and function of a population of suppressive cells, termed regulatory T cells (Treg).
References
  • Slavik JM, et al. (1999) CD28/CTLA-4 and CD80/CD86 families: signaling and function. Immunol Res. 19(1): 1-24.
  • Holmberg D, et al. (2005) CTLA-4 (CD152) and its involvement in autoimmune disease. Autoimmunity. 38(3): 225-33.
  • Chin LT, et al. (2008) Immune intervention with monoclonal antibodies targeting CD152 (CTLA-4) for autoimmune and malignant diseases. Chang Gung Med J. 31(1): 1-15.
  • TOP