Mouse CREG1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:MGB840-NM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
663bp
Gene Synonym
Creg, AA755314, Creg1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse cellular repressor of E1A-stimulated genes 1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CREG1 belongs to the CREG family. It is a adenovirus E1A protein which both activates and represses gene expression to promote cellular proliferation and inhibit differentiation. Thus it may contribute to the transcriptional control of cell growth and differentiation. The transcriptional control activity of cell growth requires interaction with IGF2R. CREG1 also antagonizes transcriptional activation and cellular transformation by E1A. It shares limited sequence similarity with E1A and binds both the general transcription factor TBP and the tumor suppressor pRb in vitro. CREG1 gene may contribute to the transcriptional control of cell growth and differentiation.
References
  • Veal E, et al. (2000) The secreted glycoprotein CREG enhances differentiation of NTERA-2 human embryonal carcinoma cells. Oncogene. 19(17):2120-8.
  • Wen SJ, et al. (2003) Screening the proteins that interact with calpain in a human heart cDNA library using a yeast two-hybrid system. Hypertens Res. 25(4):647-52.
  • Grouse LH, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • TOP