Rat Contactin 5/CNTN5 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

NM_053746.1

RefSeq ORF Size

3300bp

Gene Synonym

Nb-2, Cntn5

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat contactin 5 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Contactins are a subgroup of molecules belonging to the immunoglobulin superfamily that are expressed mainly in the nervous system. The subgroup consists of six members: Contactin-1, Contactin-2(TAG-1), Contactin-3(BIG-1), BIG-2, Contactin-5(NB-2) and NB-3. Since their identification in the late 1980s, Contactin-1 and Contactin-2 have been studied extensively. Axonal expression and the neurite extension activity of Contactin-1 and Contactin-2 attracted researchers to study the function of these molecules in axon guidance during development. Contactin-1 and Contactin-2 have come to be known as the principal molecules in the function and maintenance of myelinated neurons. In contrast, the function of the other four members of this subgroup remained unknown until recently. Contactin-5, also known as NB-2, is one of the neural recognition molecules in the contactin subgroup. Contactin-5 is expressed in brain and kidney and at very low level in placenta. In brain, Contactin-5 is highly expressed in the occipital lobe, amygdala, cerebral cortex, frontal lobe, thalamus and temporal lobe. Mice deficient in the Contactin-5 gene exhibit aberrant responses to acoustic stimuli. Contactin-5 may play a role in maturation of glutamatergic synapses in the brainstem during the final stages of auditory development. Contactin-5 gene may contribute to human neurological disorders.

References

Kamei Y, et al. (2000) Human NB-2 of the contactin subgroup molecules: chromosomal localization of the gene (CNTN5) and distinct expression pattern from other subgroup members. Genomics 69(1):113-9.

Ogawa J, et al. (2001) Neural recognition molecule NB-2 of the contactin/F3 subgroup in rat: Specificity in neurite outgrowth-promoting activity and restricted expression in the brain regions. J Neurosci Res. 65(2):100-10.

Li H, et al. (2003) Aberrant responses to acoustic stimuli in mice deficient for neural recognition molecule NB-2. Eur J Neurosci. 17(5):929-36.

Shimoda Y, et al. (2009) Contactins: Emerging key roles in the development and function of the nervous system. Cell adhesion & migration 3(1):64-70.

Toyoshima M, et al. (2009) Preferential localization of neural cell recognition molecule NB-2 in developing glutamatergic neurons in the rat auditory brainstem. J Comp Neurol. 513(4):349-62.

Catalog Number:MGB766-NM