Rat Contactin 1/CNTN1 Gene ORF cDNA clone expression plasmid,N terminal GFP tag

Catalog Number:MGB761-NG

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
3066bp
Gene Synonym
F3, Cntn1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat contactin 1 Gene ORF cDNA clone expression plasmid,N terminal GFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-GFPSpark
Restriction Site
Protein Tag
GFPSpark
Tag Sequence
GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
GFPSpark Tag Information
GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Contactins are a subgroup of molecules belonging to the immunoglobulin superfamily that are expressed exclusively in the nervous system. The subgroup consists of six members: Contactin-1, Contactin-2 (TAG-1), Contactin-3 (BIG-1), BIG-2, Contactin-5 (NB-2) and NB-3. Since their identification in the late 1980s, Contactin-1 and Contactin-2 have been studied extensively. Axonal expression and the neurite extension activity of Contactin-1 and Contactin-2 attracted researchers to study the function of these molecules in axon guidance during development. Contactin-1 and Contactin-2 have come to be known as the principal molecules in the function and maintenance of myelinated neurons. In contrast, the function of the other four members of this subgroup remained unknown until recently. Contactin-1 is a cell surface adhesion molecule that is normally expressed by neurons and oligodendrocytes. Particularly high levels of Contactin-1 are present during brain development. Contactin-1 and Contactin-2 are differentially expressed in a number of neuronal tissues during development, and they interact with several ligands including Nr-CAM, L1, NCAM, neurocan, phosphacan, and tenascin. As a cell adhesion molecule, Contactin-1 plays a role in the formation of axon connections in the developing nervous system. It was demonstrated that Contactin-1 participates in signal pathways via its association with Contactin-associated protein (CNTNAP1), receptor protein tyrosine phosphatase beta (RPTPb) and NOTCH1. Contactin-1 is also involved in paranodal axo-glial junction formation and oligodendrocytes generation. Furthermore, studies indicated that Contactin-1 functions importantly in the invasion and metastasis of lung adenocarcinoma cells. Contactin-1 may also significantly influence the functional expression and distribution of Na+ channels in neurons.
References
  • Kazarinova NK, et al. (2001) Contactin associates with Na+ channels and increases their functional expression. J Neurosci. 21 (19):7517-25.
  • Eckerich C, et al. (2006) Contactin is expressed in human astrocytic gliomas and mediates repulsive effects. Glia. 53(1):1-12.
  • Su JL, et al. (2006) Knockdown of contactin-1 expression suppresses invasion and metastasis of lung adenocarcinoma. Cancer research 66 (5):2553-61.
  • Compton AG, et al. (2008) Mutations in contactin-1, a neural adhesion and neuromuscular junction protein, cause a familial form of lethal congenital myopathy. Am J Hum Genet. 83 (6):714-24.
  • Mikami T, et al. (2009) Contactin-1 is a functional receptor for neuroregulatory chondroitin sulfate-E. J Biol Chem. 284(7):4494-9.
  • TOP