Mouse Coagulation Factor VII Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:MGB721-NO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1341bp
Gene Synonym
Cf7, FVII, mfVII, AI132620
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse coagulation factor VII Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Coagulation factor VII, also known as Serum prothrombin conversion accelerator, Factor VII, F7 and FVII, is a member of the peptidase S1 family. Factor VII is one of the central proteins in the coagulation cascade. It is an enzyme of the serine protease class, and Factor VII (FVII) deficiency is the most frequent among rare congenital bleeding disorders. Factor VII contains two EGF-like domains, one Gla (gamma-carboxy-glutamate) domain and one peptidase S1 domain. The main role of factor VII is to initiate the process of coagulation in conjunction with tissue factor (TF). Tissue factor is found on the outside of blood vessels, normally not exposed to the blood stream. The action of the Factor VII is impeded by tissue factor pathway inhibitor (TFPI), which is released almost immediately after initiation of coagulation. Factor VII is vitamin K dependent and is produced in the liver. Upon vessel injury, tissue factor is exposed to the blood and circulating Factor VII. Once bound to TF, FVII is activated to FVIIa by different proteases, among which are thrombin (factor IIa), factor Xa, IXa, XIIa, and the FVIIa-TF complex itself. Recombinant activated factor VII (rFVIIa) is a haemostatic agent, which was originally developed for the treatment of haemophilia patients with inhibitors against factor FVIII or FIX. FVIIa binds specifically to endothelial protein C receptor (EPCR), a known cellular receptor for protein C and activated protein C, on the endothelium. rFVIIa is a novel hemostatic agent, originally developed for the treatment of hemorrhage in hemophiliacs with inhibitors, which has been successfully used recently in an increasing number of nonhemophilic bleeding conditions.
References
  • Franchini M, et al. (2007) Potential role of recombinant activated factor VII for the treatment of severe bleeding associated with disseminated intravascular coagulation: a systematic review. Blood Coagul Fibrinolysis. 18(7): 589-93.
  • Lapecorella M, et al. (2008) Factor VII deficiency: defining the clinical picture and optimizing therapeutic options. Haemophilia. 14(6): 1170-5.
  • Grottke O, et al. (2010) Activated recombinant factor VII (rFVIIa). Best Pract Res Clin Anaesthesiol. 24(1): 95-106.
  • TOP