Rat Coagulation Factor III / Tissue Factor / CD142 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

NM_013057.2

RefSeq ORF Size

888bp

Gene Synonym

MGC93621, F3

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat coagulation factor III (thromboplastin, tissue factor) Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Tissue factor (TF), also known as coagulation factor III, F3, and CD142, is a single-pass type I membrane protein which belongs to the tissue factor family. Tissue factor is one of the proteins that participate in hemostatic and inflammatory processes. Activated monocytes present in the liver increase expression of tissue factor, and while accumulating in the organ they can intensify inflammation. Tissue factor is the protein that activates the blood clotting system by binding to, and activating, the plasma serine protease, factor VIIa, following vascular injury. Tissue factor is not only the main physiological initiator of normal blood coagulation, but is also important in the natural history of solid malignancies in that it potentiates metastasis and angiogenesis and mediates outside-in signalling. Tissue factor is expressed constitutively by many tissues which are not in contact with blood and by other cells upon injury or activation; the latter include endothelial cells, tissue macrophages, and peripheral blood monocytes. Coagulation Factor III is a transmembrane glycoprotein that localizes the coagulation serine protease factor VII/VIIa (FVII/VIIa) to the cell surface. The primary function of TF is to activate the clotting cascade. The TF:FVIIa complex also activates cells by cleavage of a G-protein coupled receptor called protease-activated receptor 2 (PAR2). TF is expressed by tumor cells and contributes to a variety of pathologic processes, such as thrombosis, metastasis, tumor growth, and tumor angiogenesis. As a key regulator of haemostasis and angiogenesis, it is also involved in the pathology of several diseases, including cardiovascular, inflammatory and neoplastic conditions.

References

Morrissey JH. (2004) Tissue factor: a key molecule in hemostatic and nonhemostatic systems. Int J Hematol. 79(2): 103-8.

Milsom C, et al. (2008) Tissue factor and cancer. Pathophysiol Haemost Thromb. 36(3-4): 160-76.

Kasthuri RS, et al. (2009) Role of tissue factor in cancer. J Clin Oncol. 27(29): 4834-8.

Catalog Number:MGB719-NM