Mouse CLN2 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:MGB659-CY

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1689bp
Gene Synonym
Cln2; TPP-I
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse tripeptidyl peptidase I Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Tripeptidyl-peptidase 1 (TPP1 / CLN2) is a member of the sedolisin family of serine proteases. The protease functions in the lysosome to cleave N-terminal tripeptides from substrates, and has weaker endopeptidase activity. It is synthesized as a catalytically-inactive enzyme which is activated and auto-proteolyzed upon acidification. TPP1 / CLN2 May act as a non-specific lysosomal peptidase which generates tripeptides from the breakdown products produced by lysosomal proteinases. Defects in TPP1 / CLN2 are the cause of neuronal ceroid lipofuscinosis type 2 (CLN2), a form of neuronal ceroid lipofuscinosis which is associated with the failure to degrade specific neuropeptides and a subunit of ATP synthase in the lysosome. Neuronal ceroid lipofuscinoses are progressive neurodegenerative, lysosomal storage diseases characterized by intracellular accumulation of autofluorescent liposomal material, and clinically by seizures, dementia, visual loss, and/or cerebral atrophy.
References
  • Xin H, et al. (2007) TPP1 is a homologue of ciliate TEBP-beta and interacts with POT1 to recruit telomerase. Nature. 445(7127): 559-62.
  • O'Connor MS, et al. (2006) A critical role for TPP1 and TIN2 interaction in high-order telomeric complex assembly. Proc Natl Acad Sci U S A. 103(32): 11874-9.
  • Abreu E, et al. (2010) TIN2-tethered TPP1 recruits human telomerase to telomeres in vivo. Mol Cell Biol. 30(12): 2971-82.
  • TOP