Mouse CLL-1/MICL/CLEC12A Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:MGB657-CM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
804bp
Gene Synonym
Micl, CLL-1, D230024O04, Clec12a
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse C-type lectin domain family 12, member a Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CLEC12A is a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signaling, glycoprotein turnover, and roles in inflammation and immune response. CLEC12A is a negative regulator of granulocyte and monocyte function. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. C-type lectins are the most diverse and prevalent lectin family in immunity. Using a novel CLEC12A -specific monoclonal antibody, experiments had shown that human CLEC12A was expressed primarily on myeloid cells, including granulocytes, monocytes, macrophages, and dendritic cells. Although CLEC12A was highly N-glycosylated in primary cells, the level of glycosylation was found to vary between cell types. CLEC12A surface expression was down-regulated during inflammatory/activation conditions in vitro, as well as during an in vivo model of acute inflammation. This suggests that CLEC12A may be involved in the control of myeloid cell activation during inflammation.
References
  • Lahoud MH, et al. (2009) The C-type lectin Clec12A present on mouse and human dendritic cells can serve as a target for antigen delivery and enhancement of antibody responses. J Immunol. 182(12): 7587-94.
  • Pyz E, et al. (2008) Characterisation of murine MICL (CLEC12A) and evidence for an endogenous ligand. Eur J Immunol. 38(4): 1157-63.
  • Marshall AS, et al. (2006) Human MICL (CLEC12A) is differentially glycosylated and is down-regulated following cellular activation. Eur J Immunol. 36(8): 2159-69.
  • TOP