Rat CLEC4F / CLECSF13 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:MGB648-NM

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1653bp
Gene Synonym
Kclr, Clecsf13, MGC112607, Clec4f
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat C-type lectin domain family 4, member F Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CLEC4F, a member of C-type lectins, was firstly purified from rat liver extract with high binding affinity to fucose, galactose and N-acetylgalactosamine, and un-sialylated glucosphingolipids with GalNAc or Gal terminus. However, the biological functions of CLEC4F have not been elucidated. Histochemical staining showed that mouse CLEC4F(mCLEC4F) is only expressed on F4/80+ cells localized in liver, and is undetectable in bone marrow, spleen, lymph nodes, or other tissues in adult mice. However, mCLEC4F is detected in the liver of embryonic day 11.5 (E11.5), which is 1.5 day earlier than the formation of liver (E10) and is 3.5 day earlier than the formation of bone marrow (E15-16). Moreover, recombinant mCLEC4F.Fc binds to alpha-galactoceramide in a Ca++-dependent manner, and both galactose and ceramide can partially inhibit CLEC4F.Fc binding to alpha-galactoceramide. Interestingly, mCLEC4F-deficient (mCEC4F k/o) mice produced far less cytokines than wild type littermates after intravenous injection ofalpha-galactoceramide. This suggests that mCLEC4F is not only a specific marker for Kupffer cells, but is also critical for the presentation of glycolipid antigen to NKT cells.
References
  • Shie-Liang Edmond Hsieh, et al. (2009) CLEC4F, A Kupffer Cells Specific Marker, Is Critical for Presentation of Alfa-Galactoceromide to NKT Cells. The Journal of Immunology. 182:78.
  • Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 2004 Jan;36(1):40-5.
  • Bonaldo MF, et al. (1996) Normalization and subtraction: two approaches to facilitate gene discovery. Genome Res. 1996 Sep;6(9):791-806.
  • TOP