Mouse CLEC1B/CLEC2 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Mouse

NCBI Ref Seq

NM_019985.2

RefSeq ORF Size

690bp

Gene Synonym

Clec2, Clec-2, mCLEC-2, AI465458, 1810061I13Rik, Clec1b

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse C-type lectin domain family 1, member b Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

CLEC1B, also known as CLEC2, is a C-type lectin-like receptor expressed in myeloid cells and NK cells. Natural killer (NK) cells express multiple calcium-dependent (C-type) lectin-like receptors, such as CD94 and NKG2D, that interact with major histocompatibility complex class I molecules and either inhibit or activate cytotoxicity and cytokine secretion. CLEC2 acts as a receptor for the platelet-aggregating snake venom protein rhodocytin. Rhodocytin binding leads to tyrosine phosphorylation and this promotes the binding of spleen tyrosine kinase (Syk) and initiation of downstream tyrosine phosphorylation events and activation of PLC-gamma-2. CLEC2 contains 1 C-type lectin domain and is expressed preferentially in the liver. It acts as an attachment factor for human immunodeficiency virus type 1 (HIV-1) and facilitates its capture by platelets.

References

Suzuki-Inoue K, et al. (2007) Involvement of the snake toxin receptor CLEC-2, in podoplanin-mediated platelet activation, by cancer cells. J Biol Chem. 282(36):25993-6001.

Watson AA, et al. (2007) The crystal structure and mutational binding analysis of the extracellular domain of the platelet-activating receptor CLEC-2. J Biol Chem. 282(5):3165-72.

Chaipan C, et al. (2006) DC-SIGN and CLEC-2 mediate human immunodeficiency virus type 1 capture by platelets. J Virol. 80(18):8951-60.

Catalog Number:MGB636-NM