Human CKB / Creatine kinase B type Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:MGB599-NM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1146bp
Gene Synonym
B-CK, CKBB, CKB
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human creatine kinase, brain Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CKB(Creatine kinase B type) contains 1 phosphagen kinase C-terminal domain and 1 phosphagen kinase N-terminal domain. It belongs to the ATP:guanido phosphotransferase family. CKB consists of a homodimer of two identical brain-type CK-B subunits. CKB is a cytoplasmic enzyme involved in cellular energy homeostasis, with certain fractions of the enzyme being bound to cell membranes, ATPases, and a variety of ATP-requiring enzymes in the cell. There, CKB forms tightly coupled microcompartments for in situ regeneration of ATP that has been used up. CKB reversibly catalyzes the transfer of "energy-rich" phosphate between ATP and creatine or between phospho-creatine (PCr) and ADP. Its functional entity is a homodimer in brain, smooth muscle as well as in other tissues and cells such as neuronal cells, retina, kidney, bone etc.
References
  • Wienker TF, et al. (1985) A dominant mutation causing ectopic expression of the creatine kinase B gene maps on chromosome 14. Cytogenet Cell Genet. 40:776.
  • Mariman EC, et al. (1989) Complete nucleotide sequence of the human creatine kinase B gene. Nucleic Acids Res. 17(15):6385.
  • Bong S, et al. (2008) Structural studies of human brain-type creatine kinase complexed with the ADP–Mg2+–NO3−–creatine transition-state analogue complex. FEBS Letters. 582(28): 3959-65.
  • TOP