Mouse Chordin-Like 1/CHRDL1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:MGB564-CF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1002bp
Gene Synonym
CHL, CHL1, VOPT, Nrln1, BB139951, Chrdl1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse chordin-like 1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Cordin-like 1 (CHRDL1) is an antagonist of bone morphogenetic protein 4. It may play a role in topographic retinotectal projection and in the regulation of retinal angiogenesis in response to hypoxia. Cordin-like 1 (CHRDL1) is an inhibitor of the bone morphogenetic proteins (BMPs) that have functions in inducing ectopic bone formation. CHRDL1 acheves its inhibiting ability through affecting the osteogenic differentiation of MC3T3-E1 cells. Besides its function as an antagonist, CHRDL1 enhanced the proliferation of human mesenchymal stem cells in a BMP2-independent manner.
References
  • Fernandes H, et al. (2010) Effect of chordin-like 1 on MC3T3-E1 and human mesenchymal stem cells. Cells Tissues Organs. 191 (6): 443-52.
  • Larman BW, et al. (2009) Chordin-like 1 and twisted gastrulation 1 regulate BMP signaling following kidney injury. J Am Soc Nephrol. 20 (5): 1020-31.
  • Kane R, et al. (2008) Chordin-like 1, a bone morphogenetic protein-4 antagonist, is upregulated by hypoxia in human retinal pericytes and plays a role in regulating angiogenesis. Mol Vis. 14: 1138-48.
  •  

    Chordin-Like 1/CHRDL1 related areas, pathways, and other information

    TOP