Mouse CDK2 transcript variant 2 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:MGB453-CM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
897bp
Gene Synonym
A630093N05Rik, Cdk2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse cyclin-dependent kinase 2, transcript variant 2 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
KpnI(two restriction sites) + XbaI (6kb + 0.65kb + 0.40kb)
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CDK2 is a member of the Ser/Thr protein kinase family. This protein kinase is highly similar to the gene products of S. cerevisiae cdc28, and S. pombe cdc2. It is a catalytic subunit of the cyclin-dependent protein kinase complex, whose activity is restricted to the G1-S phase, and essential for cell cycle G1/S phase transition. Cdks (cyclin-dependent kinases) are heteromeric serine/threonine kinases that control progression through the cell cycle in concert with their regulatory subunits, the cyclins. Cdks are constitutively expressed and are regulated by several kinases and phosphastases, including Wee1, CDK-activating kinase and Cdc25 phosphatase. Although there are 12 different cdk genes, only 5 have been shown to directly drive the cell cycle (Cdk1, -2, -3, -4, and -6). Following extracellular mitogenic stimuli, cyclin D gene expression is upregulated. Cdk4 forms a complex with cyclin D and phosphorylates Rb protein, leading to liberation of the transcription factor E2F. E2F induces transcription of genes including cyclins A and E, DNA polymerase and thymidine kinase. Cdk4-cyclin E complexes form and initiate G1/S transition. Subsequently, Cdk1-cyclin B complexes form and induce G2/M phase transition. Cdk1-cyclin B activation induces the breakdown of the nuclear envelope and the initiation of mitosis. CDK2 associates with and regulated by the regulatory subunits of the complex including cyclin A or E, CDK inhibitor p21Cip1 (CDKN1A) and p27Kip1 (CDKN1B). Its activity is also regulated by its protein phosphorylation. CDK2 is involved in the control of the cell cycle. It also interacts with cyclins A, B1, B3, D, or E. Activity of CDK2 is maximal during S phase and G2.
References
  • Bao ZQ, et al. (2011) Briefly bound to activate: transient binding of a second catalytic magnesium activates the structure and dynamics of CDK2 kinase for catalysis. Structure. 19(5):675-90.
  • Neganova I, et al. (2011) An important role for CDK2 in G1 to S checkpoint activation and DNA damage response in human embryonic stem cells. Stem Cells. 29(4):651-9.
  • Li J, et al. (2011) Phosphorylation of MCM3 protein by cyclin E/cyclin-dependent kinase 2 (Cdk2) regulates its function in cell cycle. J Biol Chem. 286(46):39776-85.
  • Buis J, et al. (2012) Mre11 regulates CtIP-dependent double-strand break repair by interaction with CDK2. Nat Struct Mol Biol. 19(2):246-52.
  • TOP