Mouse CDC37 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:MGB425-NY

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1140bp
Gene Synonym
p50, p50Cdc37, Cdc37
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse cell division cycle 37 homolog (S. cerevisiae) Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CDC37 is a protein that is expressed in proliferative zones during embryonic development and in adult tissues, consistent with a positive role in proliferation and is required for cell division in budding yeast. CDC37 is though to play an important role in the establishment of signaling pathways controlling cell proliferation through targeting intrinsically unstable oncoprotein kinases such as Cdk-4, Raf-1, and src to the molecular chaperone Hsp90. Decreased Hsp90 expression can reduce the levels of microtubule-associated protein tau, whose overexpression may induce many diseases. CDC37 is considered as a co-chaperone that is classified to Hsp90's accessory proteins. It has been reported that suppression of Cdc37 destabilized tau, leading to its clearance, whereas cdc37 overexpression preserved tau.Cdc37 was found to co-localize with tau in neuronal cells and to physically interact with tau from human brain. Moreover, Cdc37 levels significantly increased with age.
References
  • Dai K, et al. (1996) P hysical Interaction of Mammalian CDC37 with CDK4. The journal of biological chemistry. 271: 22030-4.
  • Pearl LH, et al. (2005) Hsp90 and Cdc37-a chaperone cancer conspiracy. Current opinion in genetics development. 15 (1): 55-61.
  • Chen GQ, et al. (2002) TNF-Induced Recruitment and Activation of the IKK Complex Require Cdc37 and Hsp90. Molecular cell. 9 (2): 401-10.
  • TOP