Mouse CDC2 Kinase / CDK1 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Gene

Species

Mouse

NCBI Ref Seq

NM_007659.3

RefSeq ORF Size

894bp

Gene Synonym

Cdc2, Cdc2a, p34, Cdk1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse cyclin-dependent kinase 1 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

CDC2, also known as CDK1, contains 1 protein kinase domain and belongs to the protein kinase superfamily, CMGC Ser/Thr protein kinase family, CDC2/CDKX subfamily. CDC2 is a catalytic subunit of the highly conserved protein kinase complex known as M-phase promoting factor (MPF), which is essential for G1/S and G2/M phase transitions of eukaryotic cell cycle. Mitotic cyclins stably associate with CDC2 and function as regulatory subunits. The kinase activity of CDK1 is controlled by cyclin accumulation and destruction through the cell cycle. The phosphorylation and dephosphorylation of CDC2 also play important regulatory roles in cell cycle control. It is required in higher cells for entry into S-phase and mitosis. CDC2 also is a cyclin-dependent kinase which displays CTD kinase activity and is required for RNA splicing. It has CTD kinase activity by hyperphosphorylating the C-terminal heptapeptide repeat domain (CTD) of the largest RNA polymerase II subunit RPB1, thereby acting as a key regulator of transcription elongation. CDK1 is required for RNA splicing, possibly by phosphorylating SRSF1/SF2. It is involved in regulation of MAP kinase activity, possibly leading to affect the response to estrogn inhibitors.

References

Lee MG, et al. (1987) Complementation used to clone a human homologue of the fission yeast cell cycle control gene cdc2. Nature. 327(6117):31-5.

Enserink JM, et al. (2010) An overview of Cdk1-controlled targets and processes. Cell Division. 5(11): 1-41.

Ninomiya-Tsuji J, et al. (1991) Cloning of a human cDNA encoding a CDC2-related kinase by complementation of a budding yeast cdc28 mutation. Proc Natl Acad Sci. 88(20):9006-10.

Zhan Q, et al. (1999) Association with Cdc2 and inhibition of Cdc2/Cyclin B1 kinase activity by the p53-regulated protein Gadd45. Oncogene. 18(18):2892-900.

Jin S, et al. (2000) The GADD45 inhibition of Cdc2 kinase correlates with GADD45-mediated growth suppression. J Biol Chem. 275(22):16602-8.

Catalog Number:MGB415-CO