Rat CD95/APO-1/TNFRSF6 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:MGB403-NF

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
975bp
Gene Synonym
Tnfrsf6, Fas
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat Fas (TNF receptor superfamily, member 6) Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CD95 (APO-1/Fas) is an important inducer of the extrinsic apoptosis signaling pathway and therapy induced apoptosis of many tumor cells has been linked to the activity of CD95. is a prototype death receptor characterized by the presence of an 80 amino acid death domain in its cytoplasmic tail. This domain is essential for the recruitment of a number of signaling components upon activation by either agonistic anti-CD95 antibodies or cognate CD95 ligand that initiate apoptosis. The complex of proteins that forms upon triggering of CD95 is called the death-inducting signaling complex (DISC). The DISC consists of an adaptor protein and initiator caspases and is essential for induction of apoptosis. CD95 is also crucial for the negative selection of B cells within the germinal center (GC). Impairment of CD95-mediated apoptosis results in defective affinity maturation and the persistence of autoreactive B-cell clones. Changes in the expression of CD95 and/or its ligand CD95L are frequently found in human cancer. The downregulation or mutation of CD95 has been proposed as a mechanism by which cancer cells avoid destruction by the immune system through reduced apoptosis sensitivity. Thus, CD95 has therefore been viewed as a tumor suppressor. CD95 has been reported to be involved in the activation of NF-kappaB, MAPK3/ERK1, MAPK8/JNK, and the alternate pathways for CTL-mediated cytotoxicity. Accordingly, this protein is implicated in the pathogenesis of various malignancies and diseases of the immune system. The CD95/CD95L system was implicated in the etiology of inflammatory bowel disease (IBD) based, primarily, on the finding that CD95 is highly expressed in the intestinal epithelial cells and that epithelial apoptosis is increased in IBD.
References
  • Mschen M, et al. (2002) The origin of CD95-gene mutations in B-cell lymphoma. Trends Immunol. 23(2): 75-80.
  • Peter ME, et al. (2003) The CD95(APO-1/Fas) DISC and beyond. Cell Death Differ. 10(1): 26-35.
  • Peter ME, et al. (2005) Does CD95 have tumor promoting activities Biochim Biophys Acta. 1755(1): 25-36.
  • Chen L, et al. (2010) Cell death in the colonic epithelium during inflammatory bowel diseases: CD95/Fas and beyond. Inflamm Bowel Dis. 16(6): 1071-6.
  • TOP