Mouse CD6 / Cluster of Differentiation 6 transcript variant 2 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:MGB371-NF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1998bp
Gene Synonym
Cd6
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse CD6 antigen, transcript variant 2 Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
T-cell differentiation antigen CD6, also known as TP120 and CD6, is a single-pass type I membrane protein which contains three SRCR domains. CD6 / TP120 is a cell surface glycoprotein expressed primarily on T cells, it may function as a costimulatory molecule and may play a role in autoreactive immune responses. CD6 / TP120 is expressed by thymocytes, mature T-cells, a subset of B-cells known as B-1 cells, and by some cells in the brain. CD6 ligand termed CD166 (previously known as activated leukocyte cell adhesion molecule, ALCAM ) has been identified and shown to be expressed on activated T cells, B cells, thymic epithelium, keratinocytes, and in rheumatoid arthritis synovial tissue. CD6 / TP120 binds to activated leukocyte cell adhesion molecule ( CD166 ), and is considered as a costimulatory molecule involved in lymphocyte activation and thymocyte development. CD6 / TP120 partially associates with the TCR / CD3 complex and colocalizes with it at the center of the mature immunological synapse (IS) on T lymphocytes. During thymic development CD6-dependent signals may contribute both to thymocyte survival, and to the overall functional avidity of selection in both man and mouse.
References
  • Joo YS. et al., 2000, Arthritis Rheum. 43 (2): 329-35.
  • Singer NG. et al., 2002, Int Immunol. 14 (6): 585-97.
  • Gimferrer I. et al., 2005, J Immunol. 175 (3): 1406-14.
  • Alonso R. et al., 2010, J Autoimmun. 35 (4): 336-41.
  • TOP