Mouse CD5L Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:MGB369-CY

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1059bp
Gene Synonym
1/6, CT2, Pdp, Api6, AAC-11, AI047839, Sp-alpha
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse CD5 antigen-like Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CD5L, also known as CD5 antigen-like, is a soluble protein belonging to group B of the scavenger receptor cysteine-rich (SRCR) superfamily and contains three SRCR domains. It is a secreted glycoprotein and expressed by macrophages presentin lymphoid tissues (spleen, lymph node, thymus, and bone marrow). It binds to myelomonocytic and lymphoid cells and may play an important role in the regulation of the innate and adaptive immune systems. CD5L functions as a pattern recognition molecule by binding both lipoteichoic acid (LTA) on Gram positive and lipopolysaccharide (LPS) on Gram negative bacteria. and the SRCR domain 1 of CD5L retains both the LPS and LTA binding activities. In addtion, it is revealed that CD5L seems to play a role as an inhibitor of apoptosis.
References
  • Resnick, D. et al., 1994, Trends Biochem. Sci. 19: 5-8.
  • Gebe, J. A. et al., 1997, J. Biol. Chem. 272 (10): 6151–6158.
  • Sarrias, M.R. et al., 2004, Crit. Rev. Immunol. 24: 1-37.
  • Mukhopadhyay, S. and Gordon, S., 2004, Immunobiology 209: 39-49.
  • Sarrias, M. R. et al.,2005, J. Biol. Chem. 280 (42): 35391–35398.
  • TOP