Rat CD4 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

NM_012705.1

RefSeq ORF Size

1374bp

Gene Synonym

p55, W3/25, Cd4

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat Cd4 molecule Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

T-cell surface glycoprotein CD4, is a single-pass type I membrane protein. CD4 contains three Ig-like C2-type (immunoglobulin-like) domains and one Ig-like V-type (immunoglobulin-like) domain. CD4 is a glycoprotein expressed on the surface of T helper cells, regulatory T cells, monocytes, macrophages, and dendritic cells. The CD4 surface determinant, previously associated as a phenotypic marker for helper/inducer subsets of T lymphocytes, has now been critically identified as the binding/entry protein for human immunodeficiency viruses (HIV). The human CD4 molecule is readily detectable on monocytes, T lymphocytes, and brain tissues. All human tissue sources of CD4 bind radiolabeled gp120 to the same relative degree; however, the murine homologous protein, L3T4, does not bind the HIV envelope protein. CD4 is a co-receptor that assists the T cell receptor (TCR) to activate its T cell following an interaction with an antigen presenting cell. Using its portion that resides inside the T cell, CD4 amplifies the signal generated by the TCR. CD4 interacts directly with MHC class II molecules on the surface of the antigen presenting cell via its extracellular domain. The CD4 molecule is currently the object of intense interest and investigation both because of its role in normal T-cell function, and because of its role in HIV infection. CD4 is a primary receptor used by HIV-1 to gain entry into host T cells. HIV infection leads to a progressive reduction of the number of T cells possessing CD4 receptors.

References

Farrar WL, et al. (1988) Characterization of CD4 glycoprotein determinant-HIV envelope protein interactions: perspectives for analog and vaccine development. Crit Rev Immunol. 8(4): 315-39.

Biddison WE, et al. (1989) CD4 expression and function in HLA class II-specific T cells. Immunol Rev. 109: 5-15.

Singh SK, et al. (2012) Mapping the interaction between the cytoplasmic domains of HIV-1 viral protein U and human CD4 with NMR spectroscopy. FEBS J. 279(19):3705-14.

Catalog Number:MGB350-CM