Rat CD3d/CD3 delta Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:MGB347-NO

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
522bp
Gene Synonym
Cd3d
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat CD3 molecule, delta Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
T-cell surface glycoprotein CD3 delta chain, also known as CD3D, is a single-pass type I membrane protein. CD3D, together with CD3-gamma, CD3-epsilon and CD3-zeta, and the T-cell receptor alpha/beta and gamma/delta heterodimers, forms the T cell receptor-CD3 complex. The majority of T cell receptor (TCR) complexes in mice and humans consist of a heterodimer of polymorphic TCRalpha and beta chains along with invariant CD3gamma, delta, epsilon, and zeta chains. CD3 chains are present as CD3gammaepsilon, deltaepsilon, and zetazeta dimers in the receptor complex and play critical roles in the antigen receptor assembly, transport to the cell surface, and the receptor-mediated signal transduction. T cell receptor-CD3 complex plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. This complex is critical for T-cell development and function, and represents one of the most complex transmembrane receptors. The T cell receptor-CD3 complex is unique in having ten cytoplasmic immunoreceptor tyrosine-based activation motifs (ITAMs). CD3D contains 1 ITAM domain and has been shown to interact with CD8A. In the mouse, knockout of CD3delta allows some degree of T lymphocyte differentiation since mature CD4 and CD8 as well as TCRgammadelta T lymphocytes are observed in the periphery. In contrast, deleterious mutation of the CD3delta encoding gene in the human leads to a severe combined immunodeficiency characterised by the complete absence of mature T cell subpopulations including TCRalpha/beta and TCRgamma/delta. Defects in CD3D cause severe combined immunodeficiency autosomal recessive T-cell-negative/B-cell-positive/NK-cell-positive (T-/B+/NK+ SCID) which is a genetically and clinically heterogeneous group of rare congenital disorders characterized by impairment of both humoral and cell-mediated immunity, leukopenia, and low or absent antibody levels. In humans the absence of CD3 delta results in a complete arrest in thymocyte development at the stage of double negative to double positive transition and the development of gamma delta T-cell receptor-positive T cells is also impaired.
References
  • Roifman CM. (2004) CD3 delta immunodeficiency. Curr Opin Allergy Clin Immunol. 4(6): 479-84.
  • Pan Q, et al. (2006) Different role for mouse and human CD3delta/epsilon heterodimer in preT cell receptor (preTCR) function: human CD3delta/epsilon heterodimer restores the defective preTCR function in CD3gamma- and CD3gammadelta-deficient mice. Mol Immunol. 43(11): 1741-50.
  • Le Deist F, et al. (2007) Expression anomalies of the CD3-TCR complex expression and immunodeficiencies. Med Sci (Paris). 23(2): 161-6.
  • TOP