Rat CD34 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Gene

Species

Rat

NCBI Ref Seq

NM_001107202.2

RefSeq ORF Size

1161bp

Gene Synonym

Cd34

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat CD34 molecule Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Cluster of Differentiation 34 (CD34) is a member of a family of single-pass transmembrane sialomucin proteins, and may function as a cell-cell adhesion factor. CD34 protein is selectively expressed on hematopoietic progenitor cells and the small vessel endothelium of a variety of tissues. It has been widely used as a stem and progenitor cell marker, and clinical CD34+ stem cell transplantation (CD34+SCT) has been performed for tumor purging. CD34 monoclonal antibodies are widely used to identify and isolate hemopoietic progenitors and to classify acute and chronic leukemias.

References

Hogan CJ, et al. (2002) Differential long-term and multilineage engraftment potential from subfractions of human CD34+ cord blood cells transplanted into NOD/SCID mice. Proc Nat Acad Sci USA. 99 (1): 413-8.

Nielsen JS,et al. (2009) CD34 is a key regulator of hematopoietic stem cell trafficking to bone marrow and mast cell progenitor trafficking in the periphery. Microcirculation. 16(6): 487-96.

Mastrandrea F,et al. (2009) CD34+ hemopoietic precursor and stem cells traffic in peripheral blood of celiac patients is significantly increased but not directly related to epithelial damage severity. Eur Ann Allergy Clin Immunol. 40(3): 90-103.

Pasquet S,et al. (2009) Long-term benefit of intracardiac delivery of autologous granulocyte-colony-stimulating factor-mobilized blood CD34+ cells containing cardiac progenitors on regional heart structure and function after myocardial infarct. Cytotherapy. 11(8): 1002-15.

Catalog Number:MGB340-NO