Rhesus CD208/DC-LAMP Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Gene

Species

Rhesus

NCBI Ref Seq

NM_001032872.1

RefSeq ORF Size

1251bp

Gene Synonym

LAMP3

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rhesus lysosomal-associated membrane protein 3 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Dendritic cell-lysosomal associated membrane protein (DC-LAMP)/CD208, also known as LAMP3, is a member of the lysosomal associated membrane protein (LAMP) family, which is specifically expressed by human dendritic cells (DCs) upon activation and therefore serves as marker of human DC maturation. Confocal and immunoelectron microscopy showed that mouse DC-LAMP protein co-localizes with lbm180, a specific marker for the limiting membrane of lamellar bodies that contain surfactant protein B. The present study demonstrates that DC-LAMP is constitutively expressed by mouse, sheep, and human type II pneumocytes. DC-LAMP is constitutively expressed in normal type II pneumocytes. DC-LAMP is detected first in activated human DC within MHC class II molecules-containing compartments just before the translocation of MHC class II-peptide complexes to the cell surface, suggesting a possible involvement in this process. Furthermore, overexpression of LAMP3 is actively involved in tumor invasion through increased migration into lymph-vascular spaces.

References

Salaun B, et al. (2003) Cloning and characterization of the mouse homologue of the human dendritic cell maturation marker CD208/DC-LAMP. Eur J Immunol. 33(9): 2619-29.

Salaun B, et al. (2004) CD208/dendritic cell-lysosomal associated membrane protein is a marker of normal and transformed type II pneumocytes. Am J Pathol. 164(3): 861-71.

Ishigami S, et al. (2010) Prognostic value of CD208-positive cell infiltration in gastric cancer. Cancer Immunol Immunother. 59(3): 389-95.

Catalog Number:MGB311-NO