Rhesus CD200/OX2 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Gene

Species

Rhesus

NCBI Ref Seq

XM_001103685.2

RefSeq ORF Size

810bp

Gene Synonym

CD200

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rhesus CD200 molecule Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

CD200 (OX-2) is a cell surface glycoprotein that imparts immune privileges by suppressing alloimmune and autoimmune responses through its receptor, CD200R, expressed primarily on myeloid cells. Signals delivered through the CD200:CD200R axis have been shown to play an important role in the regulation of anti-tumor immunity, and overexpression of CD200 has been reported in a number of malignancies, including CLL, as well as on cancer stem cells. The role of CD200-CD200R signaling in immune regulation of the central nervous system has become a popular field of research in recent years. Many studies have shown that there is a close correlation between CD200-CD200R, microglia activation, and Parkinson's disease (PD). The ability of CD200 to suppress myeloid cell activation is critical for maintaining normal tissue homeostasis but may also enhance the survival of migratory neoplastic cells. CD200 and CD200R associate via their respective N-terminal Ig-like domains. CD200 has been characterized as an important immunoregulatory molecule, increased expression of which can lead to decreased transplant rejection, autoimmunity, and allergic disease. Elevated CD200 expression has been reported to be associated with poor prognosis in a number of human malignancies. In addition, CD200 also plays an important role in prevention of graft rejection, autoimmune diseases and spontaneous abortion.

References

Minas K, et al. (2006) Is the CD200/CD200 receptor interaction more than just a myeloid cell inhibitory signal? Crit Rev Immunol. 26(3): 213-30.

Wang XJ, et al. (2007) CD200-CD200R regulation of microglia activation in the pathogenesis of Parkinson's disease. J Neuroimmune Pharmacol. 2(3): 259-64.

Wong KK, et al. (2010) The role of CD200 in immunity to B cell lymphoma. J Leukoc Biol. 88(2): 361-72.

Catalog Number:MGB306-NO