Mouse CD171/L1CAM Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_008478.3

RefSeq ORF Size

3780bp

Gene Synonym

L1, CD171, L1-NCAM, NCAM-L1, L1cam

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse L1 cell adhesion molecule Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

L1 cell adhesion molecule (L1CAM), also designated as CD171, is a cell adhesion receptor of the immunoglobulin superfamily, known for its roles in nerve cell function. While originally believed to be present only in brain cells, in recent years L1-CAM has been detected in other tissues, and in a variety of cancer cells, including some common types of human cancer. L1CAM interacts with a variety of ligands including axonin-1, CD9, neurocan and intergrins, and it has been revealed that the RGD motif in the sixth Ig domain of L1CAM is a binding site for integrins, thus important for nuclear signaling. Disruption of L1CAM function causes three X-linked neurological syndromes, i.e. hydrocephalus, MASA syndrome (mental retardation, aphasia, shuffling gait and adducted thumbs) and spastic paraplegia syndrome. Overexpression of L1CAM in normal and cancer cells increased motility, enhanced growth rate and promoted cell transformation and tumorigenicity. Recent work has identified L1CAM (CD171) as a novel marker for human carcinoma progression, and a candidate for anti-cancer therapy.

References

Meier F, et al. (2006) The adhesion molecule L1 (CD171) promotes melanoma progression. Int J Cancer. 119(3): 549-55.

Gavert N, et al. (2008) L1-CAM in cancerous tissues. Expert Opin Biol Ther. 8(11): 1749-57.

Issa Y, et al. (2009) Enhanced L1CAM expression on pancreatic tumor endothelium mediates selective tumor cell transmigration. J Mol Med. 87(1): 99-112.

Weidle UH, et al. (2009) L1-CAM as a target for treatment of cancer with monoclonal antibodies. Anticancer Res. 29(12): 4919-31.

Raveh S, et al. (2009) L1 cell adhesion molecule (L1CAM) in invasive tumors. Cancer Lett. 282(2): 137-45.

Wolterink S, et al. (2010) Therapeutic antibodies to human L1CAM: functional characterization and application in a mouse model for ovarian carcinoma. Cancer Res. 70(6): 2504-15.

Catalog Number:MGB290-NY