Rat CD166/ALCAM Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Rat

NCBI Ref Seq

NM_031753.1

RefSeq ORF Size

1752bp

Gene Synonym

Alcam

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat activated leukocyte cell adhesion molecule Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Activated leukocyte cell adhesion molecule (ALCAM)/Cluster of differentiation (CD166) is a type I transmembrane cell adhesion molecule belonging to the Ig superfamily and a ligand for CD6 that is expressed on T lymphocytes. The extracellular domain of ALCAM contains five Ig-like domains (three Ig-like C2-type domains and two Ig-like V-type domains), of which the amino-terminal V1 domain is essential for ligand binding and ALCAM-mediated cell aggregation. ALCAM mediates both heterophilic (ALCAM-CD6) and homophilic (ALCAM-ALCAM) cell-cell interactions. ALCAM/CD6 interaction plays a role in T cell development and T cell regulation, as well as in the binding of T- and B-cells to activated leukocytes. Recently, homophilic (ALCAM-ALCAM) adhesion was shown to play important roles in tight cell-to-cell interaction and regulation of stem cell differentiation. While expressed in a wide variety of tissues, ALCAM is usually restricted to subsets of cells involved in dynamic growth and/or migration, including neural development, branching organ development, hematopoiesis, immune response and tumor progression. And CD166 is regarded as a potential novel breast cancer indicator and therapeutic target.

References

Swart GW. (2002) Activated leukocyte cell adhesion molecule (CD166/ALCAM): developmental and mechanistic aspects of cell clustering and cell migration. Eur J Cell Biol. 81(6): 313-21.

Fujiwara H, et al. (2003) Human blastocysts and endometrial epithelial cells express activated leukocyte cell adhesion molecule (ALCAM/CD166). J Clin Endocrinol Metab. 88(7): 3437-43.

Jezierska A, et al. (2006) ALCAM/CD166 protects breast cancer cells against apoptosis and autophagy. Med Sci Monit. 12(8): BR263-73.

Kahlert C, et al. (2009) Increased expression of ALCAM/CD166 in pancreatic cancer is an independent prognostic marker for poor survival and early tumour relapse. Br J Cancer. 101(3): 457-64.

Catalog Number:MGB288-CY