Rhesus CD16/Fc gamma RIII Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:MGB283-NM

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
765bp
Gene Synonym
FCGR3, FcRIII
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rhesus Fc gamma RIIIa Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Fc receptors bind the most common class of antibody, IgG, are called Fc gamma receptors (FcγR). FcγR is divided into three classes, Fc γ RI (CD64), Fc γ RII (CD32), and Fc γ RIII (CD16). CD16 protein is a multifunctional, low/intermediate affinity receptor, which belongs to the immunoglobulin superfamily. It is found on the surface of natural killer cells, neutrophil polymorphonuclear leukocytes, monocytes and macrophages. Mouse CD16 is encoded by a single gene, while, human CD16 is expressed as two distinct forms (CD16a/FcγRIIIa and CD16b/FcγRIIIb) encoded by two different highly homologous genes in a cell type-specific manner. CD16 is involved in phagocytosis, secretion of enzymes, inflammatory mediators, antibody-dependent cellular cytotoxicity (ADCC), and clearance of immune complexes.
References
  • Edberg JC, et al. (2002) Genetic linkage and association of Fcgamma receptor IIIA (CD16A) on chromosome 1q23 with human systemic lupus erythematosus. Arthritis Rheum. 46(8): 2132-40.
  • Li P, et al. (2002) Recombinant CD16A-Ig forms a homodimer and cross-blocks the ligand binding functions of neutrophil and monocyte Fcgamma receptors. Mol Immunol. 38(7): 527-38.
  • Li P, et al. (2007) Affinity and kinetic analysis of Fcgamma receptor IIIa (CD16a) binding to IgG ligands. J Biol Chem. 282(9): 6210-21.
  • TOP