Human CD146/MCAM Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Human

NCBI Ref Seq

NM_006500.2

RefSeq ORF Size

1941bp

Gene Synonym

MCAM, CD146, MUC18

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human melanoma cell adhesion molecule Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

The CD146 antigen, also known as melanoma cell adhesion molecule (MCAM) and MUC18, is an integral membrane glycoprotein belonging to the immunoglobulin superfamily. CD146 contains the characteristic immunoglobulin-like domains (V-V-C2-C2-C2), a transmembrane region and a short cytoplasmic tail. The CD146 expression is detected in endothelial cells in vascular tissue throughout the body, and plays a role in cell adhesion, as well as in cohesion of the endothelial monolayer at intercellular junctions in vascular tissue. As a Ca2+-independent cell adhesion molecule involved in heterophilic cell to cell interactions and a surface receptor, CD146 triggers tyrosine phosphorylation of FYN and PTK2 and subsequently induced signal transduction, proteolysis, or immune recognition. This protein is also expressed predominantly on metastatic lesions and advanced primary tumours, and thus has been suggested to play an important role in tumour progression and the development of metastasis in certain human carcinomas.

References

Mills L, et al. (2002) Fully human antibodies to MCAM/MUC18 inhibit tumor growth and metastasis of human melanoma. Cancer Res. 62(17): 5106-14.

Taira E, et al. (2004) Characterization of Gicerin/MUC18/CD146 in the rat nervous system. J Cell Physiol. 198(3): 377-87.

Fritzsche FR, et al. (2008) CD146 protein in prostate cancer: revisited with two different antibodies. Pathology. 40(5): 457-64.

Bidlingmaier S, et al. (2009) Identification of MCAM/CD146 as the target antigen of a human monoclonal antibody that recognizes both epithelioid and sarcomatoid types of mesothelioma. Cancer Res. 69(4): 1570-7.

Boneberg EM, et al. (2009) Soluble CD146 is generated by ectodomain shedding of membrane CD146 in a calcium-induced, matrix metalloprotease-dependent process. Microvasc Res. 78(3): 325-31.

Catalog Number:MGB272-CF