Rat CD132 / IL2RG Gene ORF cDNA clone expression plasmid,C terminal His tag

Catalog Number:MGB268-CH

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1107bp
Gene Synonym
Cd132, Ab2-183, Il2rg
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat interleukin 2 receptor, gamma Gene ORF cDNA clone expression plasmid,C terminal His tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-His
Restriction Site
Protein Tag
His
Tag Sequence
CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
His Tag Information

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
The common gamma chain (γc) (or CD132), also known as interleukin-2 receptor subunit gamma or IL2RG, is a member of the type I cytokine receptor family expressed on most lymphocyte (white blood cell) populations, and its gene is found on the X-chromosome of mammals. The common gamma chain (γc) (or IL2RG), is a cytokine receptor sub-unit that is common to the receptor complexes for at least six different interleukin receptors: IL-2, IL-4, IL-7, IL-9, IL-15 and interleukin-21 receptor. It is a component of multiple cytokine receptors that are essential for lymphocyte development and function. X-linked severe combined immunodeficiency (XSCID) is a rare and potentially fatal disease caused by mutations of IL2RG, the gene encoding IL2RG. IL2RG was demonstrated to be a component of the IL-4 receptor on the basis of chemical cross-linking data, the ability of IL2RG to augment IL-4 binding affinity. The observation that IL-2R gamma is a functional component of the IL-4 receptor, together with the finding that IL-2R gamma associates with the IL-7 receptor, begins to elucidate why deficiency of this common gamma chain (gamma c) has a profound effect on lymphoid function and development, as seen in X-linked severe combined immunodeficiency.
References
  • Russell SM, et al. (1993) Interleukin-2 receptor gamma chain: a functional component of the interleukin-4 receptor. Science. 262 (5141): 1880-3.
  • Miyazaki T, et al. (1994) Functional activation of Jak1 and Jak3 by selective association with IL-2 receptor subunits. Science. 266 (5187): 1045-7.
  • Takeshita T, et al. (1992) Cloning of the gamma chain of the human IL-2 receptor. Science. 257 (5068): 379-82.
  • TOP