Mouse CD13 / ANPEP Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_008486.1

RefSeq ORF Size

2901bp

Gene Synonym

Apn, Cd13, Lap-1, Lap1, p150

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse alanyl (membrane) aminopeptidase Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Aminopeptidase N (ANPEP or APN), also known as CD13, is a cell-surface metalloprotease located in the small-intestinal and renal microvillar membrane, as well as other plasma membranes. It belongs to the peptidase M1 family. CD13 plays a role in the final digestion of peptides generated from hydrolysis of proteins by gastric and pancreatic proteases and is involved in the metabolism of regulatory peptides by diverse cell types. CD13/APN is a potent regulator of angiogenesis which is essential for tumor invasion and metastasis, and its transcription in activated endothelial cells is induced by angiogenic growth factors via the RAS/MAPK pathway. In addition, this enzyme has been shown to participate in antigen processing and presentation, and accordingly, defects in this gene appear to be a cause of various types of leukemia or lymphoma and carcinomas.

References

Pasqualini R, et al. (2000) Aminopeptidase N is a receptor for tumor-homing peptides and a target for inhibiting angiogenesis.Cancer Res. 60(3): 722-7.

Mabjeesh SJ, et al. (2005) Aminopeptidase N gene expression and abundance in caprine mammary gland is influenced by circulating plasma peptide. J Dairy Sci. 88(6): 2055-64.

Dunkel B, et al. (2009) Neutrophil and platelet activation in equine recurrent airway obstruction is associated with increased neutrophil CD13 expression, but not platelet CD41/61 and CD62P or neutrophil-platelet aggregate formation. Vet Immunol Immunopathol. 131(1-2): 25-32.

Catalog Number:MGB266-NY