Mouse CCL8/MCP-2 Gene ORF cDNA clone expression plasmid,N terminal GFP tag

Catalog Number:MGB229-NG

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
294bp
Gene Synonym
HC14, Mcp2, MCP-2, Scya8, AB023418, 1810063B20Rik, Ccl8
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse chemokine (C-C motif) ligand 8 Gene ORF cDNA clone expression plasmid,N terminal GFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-GFPSpark
Restriction Site
Protein Tag
GFPSpark
Tag Sequence
GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
GFPSpark Tag Information
GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Chemokines are a family of small chemotactic cytokines, or proteins secreted by cells. Chemokines share the same structure similarities such as small size, and the presence of four cysteine residues in conserved locations in order to form their 3-dimensional shape. Some of the chemokines are considered pro-inflammatory which can be induced to recruit cells of the immune system to a site of infection during an immune response, while others are considered homeostatic and are implied in controlling the migration of cells during normal processes of tissue maintenance and development. There are four members of the chemokine family: C-C kemokines, C kemokines, CXC kemokines and CX3C kemokines. The C-C kemokines have two cysteines nearby the amino terminus. There have been at least 27 distinct members of this subgroup reported for mammals, called C-C chemokine ligands-1 to 28. Chemokine ligand 8 (CCL8), also known as monocyte chemoattractant protein 2 (MCP-2), is a small cytokine belonging to the C-C chemokine family. CCL8 functions to activate different immune cells, including mast cells, eosinophils and basophils which are involved in allergic responses, monocytes, and T cells and NK cells which are involved in the inflammatory response. CCL8's ability achieves by binding to different cell surface receptors termed chemokine receptors including CCR1, CCR2B and CCR5. It has been reported that CCL8 is a potent inhibitor of HIV-1 by virtue of its binding to CCR5 which is one of the major co-receptors for HIV-1.
References
  • Laing KJ, et al. (2004) Chemokines. Developmental and comparative immunology. 28 (5): 443-60.
  • Cocchi F, et al. (1995) Identification of RANTES, MIP-1a, and MIP-1b as the major HIV-suppressive factor produced by CD8+ T cells. Science. 270 (5243): 1811–5.
  • Hori T, et al. (2008) CCL8 is a potential molecular candidate for the diagnosis of graft-versus-host disease. Blood. 111 (8): 4403-12.
  • Biber K, et al. (2003) Expression of L-CCR in HEK 293 cells reveals functional responses to CCL2, CCL5, CCL7, and CCL8. Journal of Leukocyte Biology. 74 (2): 243-51.
  •  

    CCL8/MCP-2 related areas, pathways, and other information

    TOP