Rhesus CCL24/Eotaxin-2/MPIF-2 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:MGB220-NM

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
360bp
Gene Synonym
CCL24
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rhesus chemokine (C-C motif) ligand 24 Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CCL24, also known as Eotaxin-2 and MPIF-2, belongs to the intercrine beta (chemokine CC) family. CCL24 gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. CCL24 displays chemotactic activity on resting T lymphocytes, a minimal activity on neutrophils, and is negative on monocytes and activated T lymphocytes. CCL24 is also a strong suppressor of colony formation by a multipotential hematopoietic progenitor cell line. CCL24 is chemotactic for resting T-lymphocytes, and eosinophils. It has lower chemotactic activity for neutrophils but none for monocytes and activated lymphocytes. It is a strong suppressor of colony formation by a multipotential hematopoietic progenitor cell line. Eotaxin-2 interacts with chemokine receptor CCR3 to induce chemotaxis in eosinophils. Elevated level of Eotaxin-2 has been seen in patients with aspirin-exacerbated respiratory disease.
References
  • Manousou P, et al. (2010) Increased expression of chemokine receptor CCR3 and its ligands in ulcerative colitis: the role of colonic epithelial cells in in vitro studies. Clin Exp Immunol. 162 (2): 337-47.
  • Owczarek W, et al. (2010) Analysis of eotaxin 1/CCL11, eotaxin 2/CCL24 and eotaxin 3/CCL26 expression in lesional and non-lesional skin of patients with atopic dermatitis. Cytokine. 50 (2): 181-5.
  • Luesink M, et al. (2009) Chemokine induction by all-trans retinoic acid and arsenic trioxide in acute promyelocytic leukemia: triggering the differentiation syndrome. Blood. 114 (27): 5512-21.
  • TOP