Rat Cathepsin L/CTSL1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:MGB144-NM

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1005bp
Gene Synonym
CatL, Ctsl, CATHL
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat cathepsin L1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Cathepsin L is a lysosomal cysteine protease that plays a major role in intracellular protein catabolism, and is potent in degrading collagen, laminin, elastin, as well as alpha-1 protease inhibitor and other structural proteins of basement membranes. It is secreted by liver flukes at all stages of their development in the mammalian host, are believed to play important roles in facilitating parasite migration (tissue degradation), feeding and immuno-evasion. Like many proteases, Cathepsin L is synthesized as an inactive preproenzyme, and cleavage of the 96-residue proregion is necessary to generate the fully active 221-residue mature enzyme. Studies have demonstrated that cleavage of the proregion occur autocatalytically under acidic conditions. The enzyme takes part in nutrient acquisition by catabolizing host proteins to absorbable peptides, facilitates the migration of the parasite through the host intestine and liver by cleaving interstitial matrix proteins such as fibronectin, laminin and native collagen and is implicated in the inactivation of host immune defenses by cleaving immunoglobulins. Recently, Cathepsin L has been shown to suppress Th1 immune response in infected laboratory animals making them susceptible to concurrent bacterial infections. Cathepsin L is synthesized in large amounts and secreted by many malignantly transformed cells, and induced by growth factors and tumor promoters. In addition to its role in protein degradation, evidence has accumulated for the participation of Cathepsin L in various physiological and pathological processes, such as tumor invasion and metastasis, bone resorption, spermatogenesis, and arthritis. Accordingly, Cathepsin L may prove useful as a diagnostic or prognostic marker of human tumor malignancy.
References
  • Mulcahy G, et al. (2001) Cathepsin L proteinases as vaccines against infection with Fasciola hepatica (liver fluke) in ruminants. Res Vet Sci. 70(1): 83-6.
  • Dixit AK, et al. (2008) Immunodiagnostic/protective role of cathepsin L cysteine proteinases secreted by Fasciola species. Vet Parasitol. 154(3-4): 177-84.
  • Leto G, et al. (2010) Cathepsin L in metastatic bone disease: therapeutic implications. Biol Chem. 391(6): 655-64.
  • TOP