Human Carboxypeptidase E/CPE Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:MGB111-CY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1431bp
Gene Synonym
CPE
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human carboxypeptidase E Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Carboxypeptidase E (CPE), also known as Carboxypeptidase H, is a peripheral membrane protein and a zinc metallocarboxypeptidase, and the conversion of proCPE into CPE occurs primarily in secretory vesicles. The active form of CPE cleaves C-terminal amino acid residues of the peptide, and is thus involved in the biosynthesis of peptide hormones and neurotransmitters including insulin, enkephalin, etc. The enzymatic activity is enhanced by millimolar concentrations of Co2+. It has also been proposed that membrane-associated carboxypeptidase E acts as a sorting receptor for targeting regulated secretory proteins which are mostly prohormones and neuropeptides in the trans-Golgi network of the pituitary and in secretory granules into the secretory pathway.Its interaction with glycosphingolipid-cholesterol rafts at the TGN facilitates the targeting. Mutations in this gene are implicated in type I I diabetes due to impaired glucose clearance and insulin resistance.
References
  • Manser, E. et al., 1990, Biochem. J. 267: 517-525.
  • Cool, D.R. et al., 1997, Cell. 88: 73-83.
  • Song, L. and Fricker, L. 1995, J. Neurochem. 65: 444-453.
  • Dhanvantari,S. et al., 2000, J. Biol. Chem. 275: 29887-29893.
  • Jeffrey, K.D. et al., 2008, Proc. Natl. Acad. Sci. U.S.A. 105: 8452-8457
  • TOP