Rat Carboxypeptidase B2/CPB2 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:MGB110-CM

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1269bp
Gene Synonym
Cpb2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat carboxypeptidase B2 (plasma) Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Carboxypeptidase B2, also known as Carboxypeptidase U, Thrombin-activable fibrinolysis inhibitor, Plasma carboxypeptidase B, CPB2, is a secreted protein which belongs to the peptidase M14 family. Carboxypeptidases are enzymes that hydrolyze C-terminal peptide bonds. The carboxypeptidase family includes metallo-, serine, and cysteine carboxypeptidases. According to their substrate specificity, these enzymes are referred to as carboxypeptidase A (cleaving aliphatic residues) or carboxypeptidase B (cleaving basic amino residues). CPB2 is activated by thrombin and acts on carboxypeptidase B substrates. After thrombin activation, the mature protein downregulates fibrinolysis. CPB2 is synthesized by the liver and circulates in the plasma as a plasminogen-bound zymogen. When it is activated by proteolysis at residue Arg92 by the thrombin / thrombomodulin complex. CPB2 cleaves C-terminal arginine or lysine residues from biologically active peptides such as kinins or anaphylatoxins in the circulation thereby regulating their activities. CPB2 exhibits carboxypeptidase activity and activated CPB2 reduces fibrinolysis by removing the fibrin C-terminal residues that are important for the binding and activation of plasminogen.
References
  • Eaton DL. et al.,1991, J Biol Chem. 266 (32): 21833-8.
  • Boffa MB. et al.,1999, Biochemistry. 38 (20): 6547-58.
  • Liu T. et al., 2005, J. Proteome Res. 4: 2070-80.
  • Valnickova Z. et al., 2006, Biochemistry. 45: 1525-35.
  • Chen R. et al., 2009, J. Proteome Res. 8: 651-61.
  • TOP